EUROtoday

Junkie blockbuster sequence: Dune and the fever of sequels, prequels and spin-offs on TV | EUROtoday

By Harley Miller on December 4, 2024

The prequel to Denis Villeneuve’s movie is launched on Max, a sequence that repeats the fever for derivatives of nice cinema hits. Read
https://www.elmundo.es/cultura/2024/12/03/6749f06221efa0f9548b4583.html

Related Posts

Actress Charlotte Lewis loses defamation go well with towards movie director Roman Polanski on enchantment | EUROtoday

VW CEO resists union stress and maintains his austerity plan | EUROtoday

The most listened to on Spotify in 2024: many ladies, besides in Spain, the place solely Karol G triumphs | Culture | EUROtoday

The 24 essential letters within the emergence of autism: GCAAGGACATATGGGCGAAGGAGA | Science | EUROtoday

Lamb, pineapple and 4 different Christmas merchandise are dearer than ever in line with the OCU | Economy | EUROtoday

The lengthy night time of martial legislation in South Korea: “I felt like I had to stop the soldiers” | International | EUROtoday

Manchester United didn’t put on a jacket in assist of the LGTBIQ+ collective after the refusal of its participant Noussair Mazraoui | Soccer | Sports | EUROtoday